Department of Bioinformatics and Computational Biology

Home > Public Software > Archive > Sequence Quality Check

This project is archived and no longer maintained.

Sequence Quality Check

hidden rowfor table layout
Overview
DescriptionThis service provides a tool to predict whether sequences represent real genes with functional products or possibly contamination/transcriptional noise given either a sequence, or a list of sequences in FASTA format.
Development Information
URL http://bioinformatics.mdanderson.org/SequenceQualityCheck/
Current version1.0
Help and Support
Contact MDACC-Bioinfo-IT-Admin@mdanderson.org 

Sequence Quality Check

Given a sequence or a list of sequences in FASTA format, this website provides a tool to predict they represent real genes with functional products or might be originated from contamination/transcriptional noise.

Procedures behind the scene:

For any question concerning QDA behind the scene, please contact Jiexin Zhang (jiexinzhang@mdanderson.org)

Corresponding publication

Jiexin Zhang, Li Zhang, Kevin Coombes.
Signatures of Gene Sequences Revealed by Mining the UniGene Affiliation Network. Bioinformatics 2006; 22: 385-391.

Sample Input Data

About input sequence(s):

The input file should be FASTA formatted DNA sequence(s), which means it begins with a single-line description, followed by lines of sequence data.The sequence must contain at least letters. Otherwise, no prediction will be made because the sequence is too short.

Sample data:

>gi|58380931|ref|XM_310883.2| Anopheles gambiae str
CAGGGTTCGGACCCAAGGGTCGCCACCTGTCGCGGCAAGCTGCAGAGCAAGCGGTGCAAGCTGAACCAGG
AAATCAACAAGGAGCTCCGGTTGCGGGCCGGTGCCGAAAACCTTTACAAGGCCACCACGAACAAGAAGCT
CAAGGACACGGTCGCACTCGAGCTGAGCTTCGTCAACTCGAACCTGCAGCTGCTGAAGGAGCAGCTGTCC
GAGCTGAACTCCTCCGTCGAGATCTACCAAAGTGAAGGCCTCGACTACGTTATACCGATGATACCGCTCG
GGCTGAAGGAAACGAAGGAGGTCAACTTTATGGAACCGTTCTCGGACTTTATTCTGGAGCACTACAGCGA
GCCGTCGCACATCTACGAGGACGCGATCGCCGACATTACCGACACGAGACAGGCCGCCAAAACGCCGACC
CGCGATGCGCAGGGCGTTTCGCTGCTGTTCCGCTACTACAACCTGCTGTACTACGTCGAGCGGCGCTTCT
TCCCGCCCGATCGCAGCCTGGGCGTGTACTTCGAATGGT
>gi|58378162|ref|XM_308283.2| Anopheles gambiae str
TTCACCGCAAACCTGCAGGGCGATTACATCAAGCATCCCGTGCTGTACGAGCTGAGCCACAAGTACGGCC
TGCCGGACAATGTGTCCGAGCAGCTGCTGCCGGACCGGCTGGAGGAGATCAAGGAGGCGATCCGGCGCGA